View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_34 (Length: 270)
Name: NF17441_low_34
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 40116661 - 40116414
Alignment:
| Q |
15 |
gttaaagtttgaagatgggattgggattgtttcgttggaatcttcttgtgttatggattttacattgggtgatgaaactgttccggttttgcttgaaccg |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40116661 |
gttaaagtttgaagatgggattgcgattgtttcgttggaatcttcttgtgttatggattttacattgggtgatgaaactgttccggttttgcttgaaccg |
40116562 |
T |
 |
| Q |
115 |
ggttcattggtgatgatgtatggtgaggctaggtatgtttggaaacatgagattaataggaaagatgctgggtttcaatcttggaagggtgaattgttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40116561 |
ggttcattggtgatgatgtatggtgaggctaggtatgtttggaaacatgagattaataggaaagatgctgggtttcaatcttggaagggtcaattgttgg |
40116462 |
T |
 |
| Q |
215 |
atcaaactacaaggacttctattactctcaggaaactctgttcttctc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40116461 |
atcaaactacaaggacttctattactctcaggaaactctgttcttctc |
40116414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University