View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_40 (Length: 250)
Name: NF17441_low_40
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 38 - 238
Target Start/End: Complemental strand, 40116381 - 40116182
Alignment:
| Q |
38 |
cttctcttttcaattttaatcaaatcagttgaatgtttagttttagatgaagctgagtttttaagccattagcattgtataattcttgtcatgattttag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
40116381 |
cttctcttttcaattttaatcaaatcagttgaatgtgtagttttagatgaagctgagtttttaagccattagcat-gtataattcttgtgatgattttag |
40116283 |
T |
 |
| Q |
138 |
aattgtggaatgagtaaagttgttacctttgggataaactattttgattaaaaaatagctactctcctttttctcattacaagtatcttctttgcaatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40116282 |
aattgtggaatgagtaaagttgttacctttgggataaactattttgattaaaaaatagctactcttctttttctcattacaagtatcttctttgcaatat |
40116183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University