View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_41 (Length: 245)
Name: NF17441_low_41
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 49538474 - 49538697
Alignment:
| Q |
1 |
agtagatgagaatgagtgtgaataagaaagacgggtggcaaaagggaaaatgtaaagtattgtgatatgcttgaaaatgtcaatgaagataagttttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49538474 |
agtagatgagaatgagtgtgaataagaaagacgagtggcaaaagg-aaaatgtaaagtattgtgatatgcttgaaaatgtcaatgaagataagttttcta |
49538572 |
T |
 |
| Q |
101 |
ttaatcttgttattttgaatgtgaagcttcattacatgcatgcaaagttatgttactttactaccctttttccttgtagtggtctagattaaaaatgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49538573 |
ttaatcttgttattttgaatgtgaagcttcattacatgcatgcaaagttatgttactttactaccctttttccttgtagtggtctagattaaaaatgtat |
49538672 |
T |
 |
| Q |
201 |
atgacttacattgtgactttactag |
225 |
Q |
| |
|
|||||||||||||||| | |||||| |
|
|
| T |
49538673 |
atgacttacattgtgaatatactag |
49538697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University