View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_44 (Length: 237)
Name: NF17441_low_44
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 36717744 - 36717956
Alignment:
| Q |
3 |
tttctgagaggaagcgtggaaggaaagtgtagctgtgtagatgtatgcatggttgggtaagggttattgggagttgctgggcaaaatgtgtattgaatca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36717744 |
tttctgagaggaagcgtggaaggaaagtgtagctgtgta------tgcatggttgggtaagggtttttgggagttgctgggcaaaatgtgtattgaatca |
36717837 |
T |
 |
| Q |
103 |
aatcaatgtgtaggatttaaggttaagggtttctgggagttgctatcaaactagtgtgtaggaatttgggggtaaacttgatttaaagagaagcaaaaat |
202 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717838 |
aaccaatgtgtaggatttaaggttaagggtttctgggagttgctatcaaactagtgtgtaggaatttgggggtaaacttgatttaaagagaagcaaaaat |
36717937 |
T |
 |
| Q |
203 |
gtttcagctgagtgcaaat |
221 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
36717938 |
gtttcagctgagtacaaat |
36717956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 37 - 147
Target Start/End: Original strand, 1483018 - 1483129
Alignment:
| Q |
37 |
gtgtagatgtatgcatggttgggtaagggttattgggagttgctgggcaaaatgtgtattgaatcaaatcaatgtgtaggatttaagg-ttaagggtttc |
135 |
Q |
| |
|
|||||| |||||||||||| | ||| |||| | ||||||||||||| |||||||| |||||| ||||| | |||||||||||||||| ||| ||||||| |
|
|
| T |
1483018 |
gtgtaggtgtatgcatggtcagctaatggttttagggagttgctgggtaaaatgtgcattgaaccaaattagtgtgtaggatttaaggattaggggtttc |
1483117 |
T |
 |
| Q |
136 |
tgggagttgcta |
147 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1483118 |
tgggagttgcta |
1483129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University