View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_47 (Length: 228)
Name: NF17441_low_47
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 11060898 - 11060676
Alignment:
| Q |
6 |
ataagaatccgagatgagattaaaatgaaaaacaccttacaacaatttcagtatttccaatatgttacatatcttatggagatctgcaacttcttgagca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11060898 |
ataagaatccgagatgagattaaaatgaaaaacaccttacaacaatttcagtatttccaatatgttacatatcttatggagatctgcaacttcttgagca |
11060799 |
T |
 |
| Q |
106 |
ctgtcttaactcataaattagtcatcaaatatcttgctaatcatatacaaagagtaaatacaaaaatctcaattaattggtggatcaggattgaacctca |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11060798 |
ccgtcttaactcataaattagtcatcaaatatcttgctaatcatatacaaagagtaaatacaaaaatctcaattaattggtggatcaggattgaacctca |
11060699 |
T |
 |
| Q |
206 |
cagactctttccaaatgagttcc |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11060698 |
cagactctttccaaatgagttcc |
11060676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 224
Target Start/End: Original strand, 29766260 - 29766316
Alignment:
| Q |
168 |
aaaatctcaattaattggtggatcaggattgaacctcacagactctttccaaatgag |
224 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| |||| || ||| |||| ||||| |
|
|
| T |
29766260 |
aaaatctcaataaataggtggatcaggattgaacttcacggattctctccagatgag |
29766316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University