View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_48 (Length: 227)
Name: NF17441_low_48
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_48 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35417433 - 35417207
Alignment:
| Q |
1 |
cacaagacataacaaccattgtctcaaattctaattccaacattgtttctcataactcattagatatgttgaaaaatttgaaggtgtttgtttatgagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417433 |
cacaagacataacaaccattgtctcaaattctaattccaacgttgtttctcataactcattagatatgttgaaaaatttgaaggtgtttgtttatgagct |
35417334 |
T |
|
| Q |
101 |
accttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417333 |
accttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtgat |
35417234 |
T |
|
| Q |
201 |
gtgagaacttttgacccttatgaagct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35417233 |
gtgagaacttttgacccttatgaagct |
35417207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 21056021 - 21056104
Alignment:
| Q |
144 |
aaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtgatgtgagaacttttgacccttatgaagct |
227 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| | || || || | ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
21056021 |
aaaactcatttatttgcttcagaagttgctattcatagagctttattaacaagtgatgtaagaacttttgacccatatgaagct |
21056104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University