View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_53 (Length: 201)
Name: NF17441_low_53
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_53 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 9 - 201
Target Start/End: Original strand, 24716872 - 24717063
Alignment:
| Q |
9 |
tgtctgtgtgctagtacaatttaacttatggcttttttgcttaagaataaagaaaactttccaaacgcgagggaaaattcacttttaaggtaagattatt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24716872 |
tgtctttgtgctagtacaatttaacttatgacttttttgcttaagaataaagaaaactttccaaacgcgggggaaaattcacttttaaggtaagattatt |
24716971 |
T |
 |
| Q |
109 |
atttcatccgtatccaatccaaatatgtcactttttcctaatgatattaatctctttcttaaagtctaattaatcatctttactatttcttca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24716972 |
atttcatccgtatccaatccaaatatgtcactttttcctaatgatattaatctctgtcttaaagtctaattaatcat-tttactatttcttca |
24717063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University