View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_high_23 (Length: 253)
Name: NF17442_high_23
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 54080954 - 54080726
Alignment:
| Q |
11 |
tttagagggtatgcagtgtatttgttgttgatactctgaagaggttttgaagtat--ttatagctgctgaatgctcttgttttggtgtgaacatgtggaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
54080954 |
tttagagggtatgcagtgtatttgttgttgatactctgaagaggttttgaagtatatttatagccgctgaatgctctagttttggtgtgaacatgtggaa |
54080855 |
T |
|
| Q |
109 |
tgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080854 |
tgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaac |
54080755 |
T |
|
| Q |
209 |
atgcacattcgcatgatttatgacatgtt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54080754 |
atgcacattcgcatgatttatgacatgtt |
54080726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 90 - 236
Target Start/End: Complemental strand, 54084228 - 54084082
Alignment:
| Q |
90 |
ttggtgtgaacatgtggaatgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttg |
189 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||| | ||| |||||||| |||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
54084228 |
ttggtgtgaaaatgcggaatgattattttaagtttgaggctagaaagtagaggagatcatattggcgtggcatatttgaatttggatggataaaaacttg |
54084129 |
T |
|
| Q |
190 |
tggttgaagccccttgaacatgcacattcgcatgatttatgacatgt |
236 |
Q |
| |
|
|||||||| | |||||||| ||| |||| |||||||||||| ||||| |
|
|
| T |
54084128 |
tggttgaaacgccttgaacttgctcattggcatgatttatggcatgt |
54084082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University