View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_high_27 (Length: 247)
Name: NF17442_high_27
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 3 - 206
Target Start/End: Original strand, 17944764 - 17944965
Alignment:
| Q |
3 |
agaacttacttcaatatannnnnnngatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgcaaagctca |
102 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| ||||||| || |||||||| ||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
17944764 |
agaacttacttcaatatatttttttgatat-ctgtcaaagat-aattatcaacactaacttatatgtccgaggaagaggaagaaaatactgcaaagctca |
17944861 |
T |
 |
| Q |
103 |
aaatcggagatggtaatcttctactccagaaatgctttgattaaaatcttcctcgtctttccctttctcgattcaacatggtaaccttctttcgtaaact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
17944862 |
aaatcggagatggtaatcttctactccagaaacgctttgaagaaaatcatcctcgtctttccctctctcgattcaacatggtaaccttctttcgaaaaca |
17944961 |
T |
 |
| Q |
203 |
ttct |
206 |
Q |
| |
|
|||| |
|
|
| T |
17944962 |
ttct |
17944965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 94
Target Start/End: Original strand, 19416571 - 19416661
Alignment:
| Q |
3 |
agaacttacttcaatatannnnnnngatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgc |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19416571 |
agaacttacttcaatatatttttttgatatcctgtcaaagataa-ttatctacactaacttacatgtctggggaagaggaagaaaatactgc |
19416661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 94
Target Start/End: Original strand, 19403393 - 19403458
Alignment:
| Q |
28 |
gatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgc |
94 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19403393 |
gatatcctgtcaaagataa-ttatctacactaacttacatgtctggggaagaggaagaaaatactgc |
19403458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University