View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_high_28 (Length: 243)
Name: NF17442_high_28
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 40454888 - 40455074
Alignment:
| Q |
41 |
tagtataaaaaataactatagaatatgatacaaataaaatatcacccgtttgttcagaagtgattattggtttaactttttggaggcatat--atgcctt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40454888 |
tagtataaaaaataactatagaatatgatacaaataaaatatcacccgtttgttcagaagtgattattggtttaactttttggaggcatatatatgcctt |
40454987 |
T |
|
| Q |
139 |
ggtgcttgctttataaccgtccatcttcttttcaccaaaagtttagctcgctgtagcatagagcttcattgtaaagatagagcagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40454988 |
ggtgcttgctttataaccgtccatcttcttttcaccaaaagtttagctcgctgtagcatagagcttcattgtaaagatagagcagtg |
40455074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University