View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_16 (Length: 302)
Name: NF17442_low_16
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 17 - 290
Target Start/End: Original strand, 37425811 - 37426084
Alignment:
| Q |
17 |
cattcatgagcccagaaagaggaaaattattgcaccaaatacacccacgaagatagccatgtacttatacgtacttggtaaacagaaatgaagcagctcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425811 |
cattcatgagcccagaaagaggaaaattattgcaccaaatacacccatgaagatagtcatgtacttatacgtacttggtaaacagaaatgaagcagctcc |
37425910 |
T |
 |
| Q |
117 |
tagaaacatatcgaaagagaccaagtgttagtttgcaggtagcctgggaagggaagagatttccaaagcacggttagaatgctggatttcagcacacttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425911 |
tagaaacatatcgaaagagaccaagtgttagtttgcaggtagcctgggaagggaagagatttccaaagcacggttagaatgctggatttcagcacacttc |
37426010 |
T |
 |
| Q |
217 |
gtcagccggaacaccattctctgattctgaatctcatatcaagctttttcaatatctactattcacatcagaat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37426011 |
gtcagccggaacaccattctctgattctgaatctcatatcaagctttttcaatatctactattcacatcagaat |
37426084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University