View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_17 (Length: 299)
Name: NF17442_low_17
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 19 - 152
Target Start/End: Complemental strand, 43283031 - 43282898
Alignment:
| Q |
19 |
ccacctcctcgtcctcctttccgaacgagctagctaggaagcttgttaatcatgtttaatctcaattactgacttgtacttgtgcagtatgttctactac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43283031 |
ccacctcctcgtcctcctttccgaacgagctagctaggaagcttgttaatcatgtttaatctcaattactgacttgtacttgtgcagtatgttctactac |
43282932 |
T |
 |
| Q |
119 |
ctctgacttgtaagaatatatagcaaggttaaga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43282931 |
ctctgacttgtaagaatatatagcaaggttaaga |
43282898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 179 - 287
Target Start/End: Complemental strand, 43282871 - 43282763
Alignment:
| Q |
179 |
cttctaaaacccccaatagaatcttctaattttattaatcatctttagataattttttactagtatgtttgtatgtttctctttatctgtctatctaatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43282871 |
cttctaaaacccccaatagaatcttctaatgttattaatcatctttagataattttttactagttagtttgtatgtttctctttatctgtctatctaatt |
43282772 |
T |
 |
| Q |
279 |
atatatatt |
287 |
Q |
| |
|
||||||||| |
|
|
| T |
43282771 |
atatatatt |
43282763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University