View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_20 (Length: 279)
Name: NF17442_low_20
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 263
Target Start/End: Original strand, 10296109 - 10296359
Alignment:
| Q |
16 |
agcagtatccctgataa---tagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaa |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296109 |
agcagtatccctgataacaatagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaa |
10296208 |
T |
 |
| Q |
113 |
ttccacttgctatctgtccttatcttgatcactacttcttagcatcttcaggaaatactgtaagttggataaaccttgtatgtttacctcttcgcataag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296209 |
ttccacttgctatctgtccttatcttgatcactacttcttagcatcttcaggaaatactgtaagttggataaaccttgtatgtttacctcttcgcataag |
10296308 |
T |
 |
| Q |
213 |
aaaactacatttggttactgttttctcatttaattattttctggttattca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10296309 |
aaaactacatttggttactgttttctcatttaattattttcttgttattca |
10296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 159
Target Start/End: Complemental strand, 43795724 - 43795595
Alignment:
| Q |
27 |
tgataatagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaattccacttgctatc |
126 |
Q |
| |
|
||||||||| || |||||||||||||||| || ||||||||| ||||||||| || ||| || |||||||| |||| | |||||| || || ||| |
|
|
| T |
43795724 |
tgataatagctttgatggcatcaaacttg---atgaaaatgaaatttggcagttccgattggcttctgcaactacatggcagggaattgtacaagcgatc |
43795628 |
T |
 |
| Q |
127 |
tgtccttatcttgatcactacttcttagcatct |
159 |
Q |
| |
|
|||||||||||||||| ||| || || |||||| |
|
|
| T |
43795627 |
tgtccttatcttgatcgctattttttggcatct |
43795595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University