View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_26 (Length: 250)
Name: NF17442_low_26
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 43017659 - 43017899
Alignment:
| Q |
15 |
aaagaggtcagaaactaactttttgactcggaaatatagatatcaactttgtttatttctcataataatgcccactagggataaagagaaaagagggtca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43017659 |
aaagaggtcagaaactaactttttgactcggaaatatagatatcaactttgtttatttctcataataatgcccactagggaaaaagagaaaagagggtca |
43017758 |
T |
 |
| Q |
115 |
agaaattaaagatactatttatagaaattaaaacaacctattttcatcttcatctttat--------tatctttaaaatgttttcataattgtatatctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43017759 |
agaaattaaagatactatttatagaaattaaaacaacctattttcatcttcatctttattatctttatatctttaaaatgttttcataattgtatatctc |
43017858 |
T |
 |
| Q |
207 |
aacacactagtactagtatttaatttctttgcatgatagaaaat |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
43017859 |
aacacactag---tagtatttaatttctttgcatgataggaaat |
43017899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University