View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_30 (Length: 241)
Name: NF17442_low_30
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 58 - 226
Target Start/End: Original strand, 1433391 - 1433559
Alignment:
| Q |
58 |
acatgcacatgtgagctgtgttacaagacttgtttatggtagataatggaattttgatgaaatgataagggtagaatgggaattttaatggatttattga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1433391 |
acatgcacatgtgagctgtgttacaagacttgtttatggtagataatggaattttgatgaaatgataagggtagaatgggaattttaatggatttattga |
1433490 |
T |
 |
| Q |
158 |
gattttctagataaatatgcatgtgtgtgagtgtggaagcatagagttggaattttgaagcaaaaactt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1433491 |
gattttctagataaatatgcatgtgtgtgagtgtggaagcatagagttggaattttgaagcaaaaactt |
1433559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University