View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_32 (Length: 238)
Name: NF17442_low_32
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 65 - 230
Target Start/End: Original strand, 32327017 - 32327181
Alignment:
| Q |
65 |
cactgcactccctcaa-gtgaaaatttcataggaggggatccgtttccagtaatacactggtaaggacaatcatgtagcaattattaatgtacattttct |
163 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327017 |
cactgcactcccacaaagtgaaaatttcataggaggggatccgtttccagtaatacacaggtaaggacaatcatgtagcaattattaatgtacattttct |
32327116 |
T |
|
| Q |
164 |
tatggtgtgtttggatctatagaaaccacgacaactgcaaaaccacgttctaatgtcatattcttcg |
230 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
32327117 |
tatggtgtgtttggatc--tagaaaccacgacaactgcaaaaccgcattctaatgtcatatttttcg |
32327181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 32322278 - 32322319
Alignment:
| Q |
1 |
gtgaaatccgagctacttttttcccacgaccgaatgtacaca |
42 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
32322278 |
gtgaaatccgagctacttgtttcccacgaccgaacgtacaca |
32322319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University