View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_35 (Length: 225)
Name: NF17442_low_35
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 39029997 - 39029799
Alignment:
| Q |
18 |
aatgcatgtatctcttcttaatcatagatttgtcacctagaaaaatgatatgcagtttaatcattagtcttaagtaacactnnnnnnnntagagacaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
39029997 |
aatgcatgtatctcttcttaatcatagatttgtcacctagaaaaatgatatgcagtttaatcattagtcttaagtaacactaaaaaaaatagagataaat |
39029898 |
T |
 |
| Q |
118 |
aaaagatatataacatggacataatttatatgcagtctaaaaatatttacattttcaatcatatgtaatcaatcactaaaatcactagaattatctacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
39029897 |
aaaagatatataacatggacataatttatatgcagtctaaaaatatttacattttcaatcatatgtaatcaatcaccaaaatcactagaaatatttacc |
39029799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 37863586 - 37863623
Alignment:
| Q |
18 |
aatgcatgtatctcttcttaatcatagatttgtcacct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37863586 |
aatgcatgtatctcttcttaatcatagatttatcacct |
37863623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University