View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17442_low_36 (Length: 225)
Name: NF17442_low_36
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17442_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 43018099 - 43017884
Alignment:
| Q |
1 |
aggaatattgtacacagaaaacaatgcaatgaaaattgactggtccttttttccacgtcagcatagtcaaaagctaatattgagcattttatacaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43018099 |
aggaatattgtacacagaaaacaatgcaatgaaaattgactggtccttttttccacgtcagcatagtcaaaagctaatattgagcattttatacaaacaa |
43018000 |
T |
|
| Q |
101 |
gacaaaggaatgcaaaaatacatgattatgtcaatgtcactagtagtacagtactatcatctttttacaaaaatgcaaatatatatgatcattgtatttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017999 |
gacaaaggaatgcaaaaatacatgattatgtcaatgtcactagtagtactg---tatcatctttttacaaaaatgcaaatatatatgatcattgtatttc |
43017903 |
T |
|
| Q |
201 |
attattttctatcatgcaa |
219 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
43017902 |
attatttcctatcatgcaa |
43017884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University