View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17443_low_9 (Length: 203)
Name: NF17443_low_9
Description: NF17443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17443_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 26 - 185
Target Start/End: Complemental strand, 11539385 - 11539226
Alignment:
| Q |
26 |
attacattcaattaattcannnnnnncaaactattactagtgtcacttcggtgcccatgtctggtgtcggtgcttcatagtagtcaagatcacattattt |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11539385 |
attacattcaattaattcatttttttcaaactattactagtgtcacttcggtgcccatgtctggtgtcggtgcttcatagtagtcaagatcacattattt |
11539286 |
T |
|
| Q |
126 |
acttgctagtatagaaccaaccatagggtaccttatgtctgtatctgtaactaacttact |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11539285 |
acttgctagtatagaaccaaccatagggtaccttatgtctgtatctgtaactaacttact |
11539226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 52 - 177
Target Start/End: Complemental strand, 34625642 - 34625513
Alignment:
| Q |
52 |
caaactattactagtgtca-cttcggtgcccatgtctggtgtcggtg---cttcatagtagtcaagatcacattatttacttgctagtatagaaccaacc |
147 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||| |||| |||||||||| ||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
34625642 |
caaactattacttgtgtcaactttggtgcccatgtttggtgttggtggtgcttcatagtatccaagatcacattatttactagctagtatagaacctacc |
34625543 |
T |
|
| Q |
148 |
atagggtaccttatgtctgtatctgtaact |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
34625542 |
atagggtaccttatgtctgtaactgtaact |
34625513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University