View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_high_12 (Length: 374)
Name: NF17445_high_12
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_high_12 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 21 - 374
Target Start/End: Complemental strand, 33581799 - 33581422
Alignment:
| Q |
21 |
gtagtaattattgttgaaggctataccgtcttgttttgagttgaagtgttatcatcttgttggaattggaggagctggttcaaaccatggtgagggagaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33581799 |
gtagtaattattgttgaaggctataccgtcttgttttgagttgaagtgttatcatcttgttggaattggaggacctggttcaaaccatggtgagggagaa |
33581700 |
T |
 |
| Q |
121 |
aaatactagcctaacaactaaatactaacatctcccgtttatnnnnnnntgtcccttcctaatc--------nnnnnnnnnnnnnacacattaactaacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33581699 |
aaatactagcctaacaactaaatactaacatcgcccttttataaaaaaatgtcccttcctaatcccctctctctctctcacacacacacattaactaacc |
33581600 |
T |
 |
| Q |
213 |
ataactgccacgctttttaactgaggtctgct---actg-agagctatagattgtaaatgatagttgtatgctcca------------gtgtgtgtgtaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
33581599 |
ataactgccacgctttttaactgaggtctgctagcacagtagagctatagattgtaaatgatagttgtatgctctagtgtgtgtgtgtgtgtgtgtgtaa |
33581500 |
T |
 |
| Q |
297 |
aaacagtagtaaattgtaactttcacaccaagtgtaaactgtaaaggaaatgtttgccgtttttgttttaccatatct |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33581499 |
aaacagtagtaaattgtaactttcacaccaagtgtaaactgtaaaggaaatgtttgccgtttttgttttaccatatct |
33581422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 32359082 - 32359038
Alignment:
| Q |
21 |
gtagtaattattgttgaaggctataccgtcttgttttgagttgaa |
65 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32359082 |
gtagcaattgttgttgaaggctataccgtcttgttttgagttgaa |
32359038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University