View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_high_13 (Length: 370)
Name: NF17445_high_13
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 74 - 353
Target Start/End: Original strand, 18794345 - 18794624
Alignment:
| Q |
74 |
atgaatttgaaaaatatttgtatatgataattcaattaacatttgtgtagtggttcataaaaaacaagttgtgcagtgatagtttcactattttagaaat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18794345 |
atgaatttgaaaaatatttgtatatgataattcaattaacatttgtgtagtggttcataaaaaacaagttgtgcagtgatagtttcactattttagaaat |
18794444 |
T |
|
| Q |
174 |
aaatttcaagagtaatatactggtaggtgtataatgtgctcatcccgataaactccagtggtattaacatgactaaactcttgaatctggattttatctt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18794445 |
aaatttcaagagtaatatactggtaggtgtataatgtgctcatcccgatttactccagtagtattaacatgactaaactcttgaatctggattttatctt |
18794544 |
T |
|
| Q |
274 |
gacaatatatgcctcaataccttaaaaagaaacaacagaatcatcaacataactatatgcaaaatattgtatgctaaaac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18794545 |
gacaatatatgcctcaataccttaaaaagaaacaacagaatcatcaacataactatatgcaaaatattgtatgctaaaac |
18794624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 18792120 - 18792185
Alignment:
| Q |
1 |
atggaattaggtgatcaaattgtataatcaaattgcatcacactttggtcaaattgcaagcacaca |
66 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18792120 |
atggaatccggtgatcaaattgtataatcaaattgcatcacaatttggtcatattgcaagcacaca |
18792185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 61
Target Start/End: Complemental strand, 27543537 - 27543503
Alignment:
| Q |
27 |
atcaaattgcatcacactttggtcaaattgcaagc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27543537 |
atcaaattgcatcacactttggtcaaattgcaagc |
27543503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 47110587 - 47110558
Alignment:
| Q |
27 |
atcaaattgcatcacactttggtcaaattg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47110587 |
atcaaattgcatcacactttggtcaaattg |
47110558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University