View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_high_35 (Length: 237)
Name: NF17445_high_35
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 66 - 220
Target Start/End: Original strand, 45934582 - 45934736
Alignment:
| Q |
66 |
ctggacagattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45934582 |
ctggacagattggaagcggtggatgggaaaccagggtggtattggtattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacatctg |
45934681 |
T |
 |
| Q |
166 |
aaatactccaatgtccgagggaaaatacttgagattgttcttgcatgtcgtttct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45934682 |
aaatactccaatgtccgagggaaaatacttgagattgtttttgcatgtcgtttct |
45934736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 45934458 - 45934506
Alignment:
| Q |
17 |
atatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934458 |
atatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
45934506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 73 - 212
Target Start/End: Original strand, 15816822 - 15816961
Alignment:
| Q |
73 |
gattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15816822 |
gattggaagcggtggatgggaaaccgtggtggtattggtattccatctgataaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
15816921 |
T |
 |
| Q |
173 |
ccaatgtccgagggaaaatacttgagattgttcttgcatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15816922 |
ccaatgtccgagggaaaatacttgagattgttcttgcatg |
15816961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 15816696 - 15816740
Alignment:
| Q |
21 |
cgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
65 |
Q |
| |
|
|||||||| |||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
15816696 |
cgaagctcaactctttatttcttcatcacaatctcaatgtggttt |
15816740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University