View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_high_37 (Length: 229)
Name: NF17445_high_37
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42813577 - 42813347
Alignment:
| Q |
1 |
acattgtacaccgacttgtattcaaatcttgtagaccatatatagtctgttatttatgaaagactagtttagctaaaatgtcaaggcagacctatttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42813577 |
acattgtacaccgacttgtattcaaatcttgtagaccatatatagtctgttatttatgaaagactagtttagctaaaatgtcaaggcagacctatttata |
42813478 |
T |
 |
| Q |
101 |
ttgactagctatcaatatcatttatcaacatattcaaca---------catagtccattggttaaatattttgttgcttacttagttgtcatcttccaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42813477 |
ttgactagctatcaatatcatttatcaacatattcaacacatacaccacatagtccattggttaaatattttgttgcttacttagttgtcatcttccaaa |
42813378 |
T |
 |
| Q |
192 |
ctgttagccattggttttttgtcttaaccct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42813377 |
ctgttagccattggttttttgtcttaaccct |
42813347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University