View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_13 (Length: 375)
Name: NF17445_low_13
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 51 - 361
Target Start/End: Original strand, 12810003 - 12810313
Alignment:
| Q |
51 |
gtaagcaagacactatcattgactattttcttttgttggattgatatctactcattattaggtaataaataaggtattttgctcgatcatgcgctgtttt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
12810003 |
gtaagcaagacactatcattgactattttcttttgttggattgatatccactcattattaggtaataaatacggtattttgcacgatcatgtgctgtttt |
12810102 |
T |
 |
| Q |
151 |
cttttttcccgtcaaagccacatgtccaactactaagtcacatgctaacaaatcacgtggattccaaaatcaataaatccgcaaggcccaagcaatc-aa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12810103 |
cttttttcccgtcaaagccacatgtccaactactaagtcacatgctaacaaagcacgtggattccaaaatcaataaatccgcaaggcccaagcaatcaaa |
12810202 |
T |
 |
| Q |
250 |
cactttatctgtttgttttgtccacattagtgcatataaatttaatatttcttgcaaaaataaatattgcagtggtactaaatttattttctaaaagttg |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12810203 |
cactttatctgcttgttttgtccacattagtgcatataaatttaatatttcttgcaaaaataaatattgcagtggtactaaa-ttattttctaaaagttg |
12810301 |
T |
 |
| Q |
350 |
aatgttaatatt |
361 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12810302 |
aatgttaatatt |
12810313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University