View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_16 (Length: 357)
Name: NF17445_low_16
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 6e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 149 - 288
Target Start/End: Complemental strand, 42648298 - 42648159
Alignment:
| Q |
149 |
ctctcacagaatctgacccagatgatgccccacgtgaatctatatactttgtttccccattagctttgcgatatgctaaaccctcagtagaatccccggg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
42648298 |
ctctcacagaatctgacccagatgatgccccacgtgaatctatatattttgttgccccattagctttgtgatatgctaaaccctcagtagaatccccagg |
42648199 |
T |
|
| Q |
249 |
ggatcccgccttctcatgagattttaatgatatatgagat |
288 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42648198 |
ggatcccgtcttctcacgagattttaatgatatatgagat |
42648159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 42648753 - 42648678
Alignment:
| Q |
18 |
gaatttggcagtttgtcataattctttaatctaatgatgtaagtcaaatttagcagtaatccttaagcaactccaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||| | ||||| |||||||| |
|
|
| T |
42648753 |
gaatttggcagtttgtcataattctttaatctaatgatgcaagttaaatttagaagtaacctttaagtaactccaa |
42648678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 305 - 344
Target Start/End: Complemental strand, 42648122 - 42648083
Alignment:
| Q |
305 |
cctttatcagagccatctttcttcaagtacagtgatgcct |
344 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42648122 |
cctttatcagagccatctttcttgaagtacagtgatgcct |
42648083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University