View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_36 (Length: 254)
Name: NF17445_low_36
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 42788174 - 42788266
Alignment:
| Q |
1 |
ctacaaacataattatccttaatggtttcactgtcaaaaactttttgcgcaataggttcaagttgattcactaaatgactattattgtcatag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42788174 |
ctacaaacataattatccttaatggtttcactgtcaaaaactttttgcacaataggttcaagttgattcactaaatgactattactgtcatag |
42788266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 42788292 - 42788360
Alignment:
| Q |
116 |
atgtatatgtatttggaatattgataaagttctgatcaacaatattatagttttgggttgcagcatcac |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42788292 |
atgtatttgtatttggaatattgataaaattctgatcaacaatattatagttttgggtggcagcatcac |
42788360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University