View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_38 (Length: 246)
Name: NF17445_low_38
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 21 - 236
Target Start/End: Original strand, 37463270 - 37463486
Alignment:
| Q |
21 |
aaattactttcaacgataacttagattcctagatagagcatta-tatatatgagcattcaatgtgaagaaaaatcatactaattacaattgtaattcata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37463270 |
aaattactttcaacgataacttagattcctagatagagcattaatatatatgagcattcaatgtgaagaaaaatcatactaattaca-ttgtaattcata |
37463368 |
T |
|
| Q |
120 |
gggaataaatatacatcctatcaaaactggtcaaaaaccgagcaaagcagcagaatccttcagaaaactgaagcgctgagtcataatatttt-ttgttgt |
218 |
Q |
| |
|
| |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
37463369 |
gtgaataaatatacatcctaccaaaactgatcaaaaaccgagcaaagcagcagaatccttcagaaaactgaagcgttgagtcataattttttgttgttgt |
37463468 |
T |
|
| Q |
219 |
atgaatcgttaccctatg |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37463469 |
atgaatcgttaccctatg |
37463486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University