View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_43 (Length: 227)
Name: NF17445_low_43
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 51123633 - 51123429
Alignment:
| Q |
18 |
cattgctttggttgatttcaattgctaggtaaaaacacagtaaatgtgatcagtgatccaaacaaagcaagg----------ccatgtttgcttaataac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51123633 |
cattgctttggttgatttcaattgctaggtaaaaacacagtaaatgtgatcagtgatccaaacaaagcaaggaactgcaaggccatgtttgcttaataac |
51123534 |
T |
 |
| Q |
108 |
acttggattattattgtgaaaaaatatttattattgaactatataatatgcagcattttgacaaaaactaaatgaacgtattagtatttcttcgtacttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51123533 |
acttggattattattgtgaaaaaatatttatt---gaactatataatatgcagcattttgacaaaaactaaatgaacgtattagtatttcttcgtacttg |
51123437 |
T |
 |
| Q |
208 |
gtgatgat |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
51123436 |
gtgatgat |
51123429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University