View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_46 (Length: 206)
Name: NF17445_low_46
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_46 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 246793 - 246588
Alignment:
| Q |
1 |
caatctttcaacctagtttannnnnnnggggttttacgtgggttttactatcatgtgatggtataaaaggggaaaacttgttcttgaaagtttccatacc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
246793 |
caatctttcaacctagtttatttttttggggttttacgtgggttttactatcatgtgatggtataaaaggggaaaacttgttcttgaaagtttccatacc |
246694 |
T |
 |
| Q |
101 |
ttggcttcctgggtttcacataaaaattcaatttttaagcttagttccagaattatacaatctgggtctttgaaatcgggttccaaaggagctaacttta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
246693 |
ttggcttccagggtttcacataaaaattcaatttttaagcttagttccagaattatacaatctgggtctttgaaatcgggttccaaaggagctaacttta |
246594 |
T |
 |
| Q |
201 |
atgggt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
246593 |
atgggt |
246588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University