View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17445_low_47 (Length: 202)
Name: NF17445_low_47
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17445_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 76 - 182
Target Start/End: Complemental strand, 19055494 - 19055388
Alignment:
| Q |
76 |
gttcaatgctttgttgaaatttcctctcaaatctttaattactactgtgtatccatctaatttcgtaagagtgactcatgtttcaacctccaacttcaca |
175 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19055494 |
gttcaatgctttgttggaattttctctcaaatctttaattactactgtgtttccgtctaattttgtaagagtgactcatgtttcaacctccaacttcaca |
19055395 |
T |
 |
| Q |
176 |
ctatcac |
182 |
Q |
| |
|
||||||| |
|
|
| T |
19055394 |
ctatcac |
19055388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University