View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_high_18 (Length: 291)
Name: NF17446_high_18
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 52592238 - 52592511
Alignment:
| Q |
1 |
gaaatggagggacagatgcattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctacatgagagttgtaagc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592238 |
gaaatggagggacagatacattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctacatgagagttgtaagc |
52592337 |
T |
 |
| Q |
101 |
attggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcgtgttaaacttgattccattttgttctgctacagattcattgtagtaattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592338 |
attggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcatgttaaacttgattccattttgttctgctacagattcattgtagtaattg |
52592437 |
T |
 |
| Q |
201 |
taaggtaacaaaggactcgaggtgaacatatccatataggaccctgaagagaatgcttggttgggatacattct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592438 |
taaggtaacaaaggactcgaggtgaacatatccatataggaccctgaagagaatgcttggttgggatacattct |
52592511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University