View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_high_27 (Length: 250)
Name: NF17446_high_27
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_high_27 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0012 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 242989 - 243077
Alignment:
| Q |
46 |
caaatgacagcacgagaaacaaatcatccaccttgattataagcaacaaattgttgatagagcccaaactattaatggcacacataaaa |
134 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
242989 |
caaatgacagcacaagaaacaaatcttccactttgattataagcaacaaattgttgatagagcccaaactactaattccacacataaaa |
243077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 6710233 - 6710321
Alignment:
| Q |
46 |
caaatgacagcacgagaaacaaatcatccaccttgattataagcaacaaattgttgatagagcccaaactattaatggcacacataaaa |
134 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
6710233 |
caaatgacagcacaagaaacaaatcttccactttgattataagcaacaaattgttgatagagcccaaactactaattccacacataaaa |
6710321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 47606024 - 47606112
Alignment:
| Q |
46 |
caaatgacagcacgagaaacaaatcatccaccttgattataagcaacaaattgttgatagagcccaaactattaatggcacacataaaa |
134 |
Q |
| |
|
||||||| | ||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
47606024 |
caaatgaaaacacaagaaacaaatcttccactttgattataagcaacaaattgttgatagagcccaaactactaattccacacataaaa |
47606112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 86 - 134
Target Start/End: Complemental strand, 48719922 - 48719874
Alignment:
| Q |
86 |
aagcaacaaattgttgatagagcccaaactattaatggcacacataaaa |
134 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
48719922 |
aagcaacaaattgttgatagagctcaaactattaattccacacataaaa |
48719874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 211
Target Start/End: Original strand, 32193095 - 32193171
Alignment:
| Q |
135 |
tgatgttaacaagttgtcttaaattaaaaataccacgcatgtagttttgaaagaattttggggatcgatctattatt |
211 |
Q |
| |
|
||||||||||| |||||||| |||| |||||| |||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
32193095 |
tgatgttaacaggttgtcttgaatttaaaatatcacgcatgtacttttgaaagaattttgaggatcgatctattatt |
32193171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University