View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_low_18 (Length: 312)
Name: NF17446_low_18
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 312
Target Start/End: Original strand, 4716708 - 4717005
Alignment:
| Q |
16 |
atacacatgattttacagctaagtaaaaattcttttggcagaaagcttaaagtatgagtcagaaaagaagatgaactagtcaatgcttttttcatcc-aa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4716708 |
atacacatgattttacagctaagtaaaaattcttttggcagaaagcataaagtatgagtcagaaaagaagatgaactagtcaatgcttttttcatcctaa |
4716807 |
T |
 |
| Q |
115 |
taatgtactaatccgtacatgctaatctcatcatgtagcatcttaatcttctcaatatagtgtgaactcaaagacttcttttcaaccaccttctccattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4716808 |
taatgtactaatccgtacatgctaatctcatcatgtagcatcttaatcttctcaatatagtgtgaactcaaagacttcttttcaaccaccttttccattc |
4716907 |
T |
 |
| Q |
215 |
taatgtcatttgataacgaccctttttattttcacattgaaatttcataacacacacccttttctttaatttttcaactatcacattatcattgacca |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716908 |
taatgtcatttgataatgaccctttttattttcacattgaaatttcataacacacacccttttctttaatttttcaactatcacattatcattgacca |
4717005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University