View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_low_28 (Length: 250)
Name: NF17446_low_28
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 47502555 - 47502808
Alignment:
| Q |
1 |
tcacggtcacaacaattctttaagttgaacttcattaatcttgaatttggagatgattaaccatggttttagctgtttaaatttatgtagttgaaag--- |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47502555 |
tcacggtcacaacaattctttaagttgaacttcattaatcttgaatttggagatgattaaccatggttttagctgtttaaatttatgtagttgaaagatt |
47502654 |
T |
 |
| Q |
98 |
attatgatcaccttcaatcttataacatcattggnnnnnnnnnnnnnnngt------gttacattcattaaatggcgagttgcaattaacatttgtcatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47502655 |
attatgatcaccttcaatcttataacatcattggaagaaaaaaaaaagtgttacataattacattcattaaatggcgagttgcaattaacatttgtcatg |
47502754 |
T |
 |
| Q |
192 |
gttgaataggagttgtgcaggggtgggcagcaatcttgatgggtttcatttcag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47502755 |
gttgaataggagttgtgcaggggtgggcagcaatcttgatgggtttcatatcag |
47502808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University