View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_low_33 (Length: 238)
Name: NF17446_low_33
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 4717092 - 4717313
Alignment:
| Q |
1 |
agtttcatttttcttctcacattaaaatttcatcacacccctttaaaattttcaatcatcacattatcattgtcattgtcattaactattgtcacaccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4717092 |
agtttcatttttcttctcacattaaaatttcatcacacccctttaaaattttcaatcatcacattatcattgtcattgtcattaaatattgtcacaccct |
4717191 |
T |
 |
| Q |
101 |
catagcaagttctaaaacttttcttagtgaaagtttcaatttttcttctcacattgaaacttcaccgcaccccttatctttaaaattttcttgcaagttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4717192 |
catagcaagttctaaaacttttcttagtgaaagtttcaatttttcttctcacattgaaacttcaccacaccccttatctttaaaattttcttgcaagttc |
4717291 |
T |
 |
| Q |
201 |
taatctttcatcatggaaaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4717292 |
taatctttcatcatggaaaaac |
4717313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University