View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17446_low_36 (Length: 220)
Name: NF17446_low_36
Description: NF17446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17446_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 29228831 - 29228643
Alignment:
| Q |
18 |
gttacgaatttccaattcaacaatgttgaaatttcactgaacaattagggttttgaagaaaggggaatgagagttcgctcatggcactggctaatgctgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29228831 |
gttacgaatttccaattcaacaatgttgaaatttcactgaacaattagggttttgaagaaaggggaatgagagttcgctcatggcactggctaatgctgc |
29228732 |
T |
 |
| Q |
118 |
agtgatcggtccttctctgtatagcgttgctcgcatcacgaaagctccttttcctggttcacatggagaaattggttctagattctgtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29228731 |
agtgatcggtccttctctgtatagcgttgctcgcatcacgaaagctccttttccaggttcacatggagaaattggttctagattttgtg |
29228643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University