View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17447_high_12 (Length: 253)
Name: NF17447_high_12
Description: NF17447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17447_high_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 253
Target Start/End: Complemental strand, 5106407 - 5106163
Alignment:
| Q |
9 |
agtagcaaagggccacaaaaactgttcaaactattagacatgtttgagtcattggagaaactcaaaccatatgtacttgaaatctttgatggtgaatccg |
108 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106407 |
agtaacaaagagccacaaaaactgttcaaactattagacatgtttgagtcattggagaaactcaaaccatatgtacttgaaatctttgatggtgaatccg |
5106308 |
T |
|
| Q |
109 |
gcgaggatatctgtgcgcgctttcgcgagcttgagaagctaatcattgatgcatcaagcaaagtattttgggaattcgggttgcaaattgaaggaaacgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106307 |
gcgaggatatctgtgcgcgctttcgcgagcttgagaagctaatcattgatgcatcaagcaaagtattttgggaattcgggttgcaaattgaaggaaacgt |
5106208 |
T |
|
| Q |
209 |
cgacggttttctcccgcctccacaagatggttctgttccaaaaat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106207 |
cgacggttttctcccgcctccacaagatggttctgttccaaaaat |
5106163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University