View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17447_high_5 (Length: 333)
Name: NF17447_high_5
Description: NF17447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17447_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 6 - 317
Target Start/End: Original strand, 16837184 - 16837495
Alignment:
| Q |
6 |
agaagcataggaatcattactggcattggatgtctctccaacgttccttttagaacctacaaaatgcctacgcggccgactgtgtttctccgttttagag |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16837184 |
agaaacataggaatcattactggcattggatgtctctccaacgttccttttagaacctacaaaatgcctacgcggccgactgtgtttctccgttttagag |
16837283 |
T |
 |
| Q |
106 |
gaagctagagaatggctgtggtcctcaacaaactttgtcactgtccaatatttatcttttctctctatcctaagcattgcatcgcaacttgccacattct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16837284 |
gaagctagagaatggctgtggtcctcaacaaactttgtcactgtccaatatttatcttttctctctatcctaagcattgcatcgcaacttgccacattct |
16837383 |
T |
 |
| Q |
206 |
tcctttttaatacttcattagaacaagtaatgtcccaaaattcaattgaaccgacacggttgaattgacaaaagccgatgctaaatcctacatgtcttgc |
305 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16837384 |
tccttttgaatacttcattagaacaagtaatgtcccaaaattcaattgaaccgacatggttgaattgacaaaagccgatgctaaatcctacatgtcttgc |
16837483 |
T |
 |
| Q |
306 |
atatgcactata |
317 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16837484 |
atatgcactata |
16837495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 259 - 313
Target Start/End: Original strand, 32216446 - 32216500
Alignment:
| Q |
259 |
acacggttgaattgacaaaagccgatgctaaatcctacatgtcttgcatatgcac |
313 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
32216446 |
acacggttgaattgacaaacgtcgatgctaaatccaacatgtcttgcatatgcac |
32216500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 313
Target Start/End: Complemental strand, 32216392 - 32216338
Alignment:
| Q |
259 |
acacggttgaattgacaaaagccgatgctaaatcctacatgtcttgcatatgcac |
313 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32216392 |
acacagttgaattgacaaacgtacatgctaaatcctacatgtcttgcatatgcac |
32216338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University