View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17447_low_12 (Length: 273)
Name: NF17447_low_12
Description: NF17447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17447_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 1180668 - 1180547
Alignment:
| Q |
18 |
atgattatgatacctgccatgtatcaaagaaaaggaaatggattatagatctgattatgtagcaaatggataatataagttttaattttgatgttgccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180668 |
atgattatgatacctgccatgtatcaaagaaaaggaaatggattatagatctgattatgtagcaaatggataatataagttttaattttgatgttgccat |
1180569 |
T |
 |
| Q |
118 |
ccataactgatgtagaaggtaa |
139 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
1180568 |
ccatagttgatgtagaaggtaa |
1180547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 168 - 246
Target Start/End: Complemental strand, 1180512 - 1180434
Alignment:
| Q |
168 |
tagaacttctctcgtctttcttcgcaagtttgaaggaaaaagcaaaagcgtgggacccacaccaatttagcatctctcg |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180512 |
tagaacttctctcgtctttcttcgaaagtttgaagggaaaagcaaaagcgtgggacccacaccaatttagcatctctcg |
1180434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 6e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 168 - 255
Target Start/End: Complemental strand, 1155892 - 1155805
Alignment:
| Q |
168 |
tagaacttctctcgtctttcttcgcaagtttgaaggaaaaagcaaaagcgtgggacccacaccaatttagcatctctcgcctatttct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155892 |
tagaacttctctcgtctttcttcgcaagtttgaagggaaaagcaaaagcgtgggacccacaccaatttagcatctctcgcctatttct |
1155805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 1156490 - 1156403
Alignment:
| Q |
18 |
atgattatgatacctgccatgtatcaaagaaaaggaaatggattatagatctgattatgtagcaaatggataatataagttttaattt |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1156490 |
atgattatgatacttgccatgtatcaaagaaaaggaaatggattatagatctgattatgtagcaaatgaataatataagttttaattt |
1156403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 1155963 - 1155917
Alignment:
| Q |
97 |
ttttaattttgatgttgccatccataactgatgtagaaggtaaaggt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
1155963 |
ttttaattttgatgttgccatccatagctgatgtagaaggtaagggt |
1155917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 168 - 245
Target Start/End: Complemental strand, 50365689 - 50365612
Alignment:
| Q |
168 |
tagaacttctctcgtctttcttcgcaagtttgaaggaaaaagcaaaagcgtgggacccacaccaatttagcatctctc |
245 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||| || || | |||||||||||||||||||||| | ||| |||||| |
|
|
| T |
50365689 |
tagagcttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaataagcctctctc |
50365612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University