View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17449_high_5 (Length: 246)
Name: NF17449_high_5
Description: NF17449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17449_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 7211796 - 7211558
Alignment:
| Q |
1 |
attttggagcttcgacaaaatcatggtgccat--cgtgatttcgtcaaagcacttataactttgtacataagtaaggaggaaatacttaatttaacaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7211796 |
attttggagcttcgacaaaatcatggtgccatatcatgatttcgtcaaagcacttataactttgtacataagtaagga---aatacttaatttaacaaaa |
7211700 |
T |
|
| Q |
99 |
tcatggtgtcatcgtgatttcgtcaaaggatatagaatatagcgaaggaggatagggaacttactaaatgtaccaagatacaagtccttgtttcctgcaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211699 |
tcatggtgtcatcgtgatttcgtcaaaggatatagaatatagcgaaggaggatagggaacttactaaatgtaccaagatacaagtccttgtttcctgcaa |
7211600 |
T |
|
| Q |
199 |
cccttccaatccgagcctgccaccttccatgttgatgatgtc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7211599 |
cccttccaatccgagcctgccaccttccatgttgatggtgtc |
7211558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 240
Target Start/End: Original strand, 30618714 - 30618768
Alignment:
| Q |
186 |
ttgtttcctgcaacccttccaatccgagcctgccaccttccatgttgatgatgtc |
240 |
Q |
| |
|
||||| |||||||| |||||||||| ||| ||||| || |||||||||||||||| |
|
|
| T |
30618714 |
ttgttgcctgcaactcttccaatcctagcttgccatctaccatgttgatgatgtc |
30618768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University