View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1744_high_6 (Length: 246)
Name: NF1744_high_6
Description: NF1744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1744_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 33 - 237
Target Start/End: Complemental strand, 45043245 - 45043042
Alignment:
| Q |
33 |
gtagtaggatgatcttttatctcgttttaattatttccccttttaggaaaattttgattagagatcccttctttt-atctggggannnnnnn-agcttgg |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
45043245 |
gtagtaggatgatcttttatctcgtttta----tttccccttttaggaaaattttgattagagatcccttttttttatctggggattttttttagcttgg |
45043150 |
T |
 |
| Q |
131 |
atgttgaactactatattgttttctcataataatattagtatcttatttgatacaata-ttaatttcccttttcggttagcatatcaattggcattaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45043149 |
atgttgaactactatattgttttctcataataatattagtatcttatttgatacaatatttaatttccctttttggttagcatatcaattggcattaatt |
45043050 |
T |
 |
| Q |
230 |
tcctttgc |
237 |
Q |
| |
|
|||||||| |
|
|
| T |
45043049 |
tcctttgc |
45043042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University