View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1745-Insertion-1 (Length: 483)
Name: NF1745-Insertion-1
Description: NF1745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1745-Insertion-1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 1e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 29146125 - 29146240
Alignment:
| Q |
7 |
atttacatgcattttttattcatgcttgattctaatatgtattagtattttgtttttgtttcttg-nnnnnnngaatgcacatagtgtcacaagtcacaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29146125 |
atttacatgcattttttattcatgcttgattctaatatgtaatagtattttgtttttgtttcttgaaaaaaaagaatgcacatagtgtcacaagtcacaa |
29146224 |
T |
|
| Q |
106 |
gagttatattcttcga |
121 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
29146225 |
gagttatatttttcga |
29146240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University