View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17450_low_2 (Length: 276)
Name: NF17450_low_2
Description: NF17450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17450_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 264
Target Start/End: Original strand, 1637206 - 1637454
Alignment:
| Q |
16 |
gaatcaactccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagcgcaacgtcgattggag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1637206 |
gaatcaactccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagggcaacgtcgattggag |
1637305 |
T |
 |
| Q |
116 |
caccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1637306 |
caccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaag |
1637405 |
T |
 |
| Q |
216 |
ggtggtcaagagtatgccactgcccacagcttcactgagcttcatctca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1637406 |
ggtggtcaagagtatgccactgcccacagcttcactgagcttcttctca |
1637454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 1612604 - 1612810
Alignment:
| Q |
19 |
tcaactccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagcgcaacgtcgattggagcac |
118 |
Q |
| |
|
|||| ||||||||| | ||||||||| || ||||||| |||| |||||||| ||||| || ||| |||||| ||| ||||||||||||||||| |
|
|
| T |
1612604 |
tcaagtccagggaacaagataggtttcgcgacttggattatggtgatgttgtagggctgggcgaaaacaactttcactagcttaacgtcgattggagcac |
1612703 |
T |
 |
| Q |
119 |
cactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaagggt |
218 |
Q |
| |
|
|||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||||||| |||| ||||||| |
|
|
| T |
1612704 |
cactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcctgaggattggtaaagggt |
1612803 |
T |
 |
| Q |
219 |
ggtcaag |
225 |
Q |
| |
|
||||||| |
|
|
| T |
1612804 |
ggtcaag |
1612810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 102 - 228
Target Start/End: Original strand, 1629223 - 1629349
Alignment:
| Q |
102 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1629223 |
aacgtcgattggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1629322 |
T |
 |
| Q |
202 |
gaggcttggaaaagggtggtcaagagt |
228 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1629323 |
gaggattggtaaagggtgatcaagagt |
1629349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 102 - 228
Target Start/End: Original strand, 1622155 - 1622281
Alignment:
| Q |
102 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1622155 |
aacgtcgatgggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1622254 |
T |
 |
| Q |
202 |
gaggcttggaaaagggtggtcaagagt |
228 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1622255 |
gaggattggtaaagggtgatcaagagt |
1622281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University