View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17451_high_5 (Length: 213)
Name: NF17451_high_5
Description: NF17451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17451_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 20146959 - 20146763
Alignment:
| Q |
1 |
gccgtgttttacccgatgacacttaatattgtttcaactttgaagattatctgtttacacaaacaaacaaaattattgtgattaaagtt--actaaaatg |
98 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
20146959 |
gccgtgttttacacgatggcacttaatattgtttcaactttgaagattattcgtttacgcaaacaaacaaaattgttgtgattaaagttttactaaaatg |
20146860 |
T |
 |
| Q |
99 |
acataacccagtcctctagatgtcctttacctgcgtcgtgagcccaagacttcaatcaccgacctacgaccgtgactgtcgtttcgtatttgttgcga |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
20146859 |
acataacc-agtcctctagatgtcctttacctgcgtcgtgagccccagacttcaatcaccgacctacgaccgtgaccgtcgttccgtatttgttgcga |
20146763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 25100633 - 25100437
Alignment:
| Q |
1 |
gccgtgttttacccgatgacacttaatattgtttcaactttgaagattatctgtttacacaaacaaacaaaattattgtgattaaagtt--actaaaatg |
98 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
25100633 |
gccgtgttttacacgatggcacttaatattgtttcaactttgaagattattcgtttacacaaacaaacaaaattgttgtgattaaagttttactaaaatg |
25100534 |
T |
 |
| Q |
99 |
acataacccagtcctctagatgtcctttacctgcgtcgtgagcccaagacttcaatcaccgacctacgaccgtgactgtcgtttcgtatttgttgcga |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
25100533 |
acataacc-agtcctctagatgtcctttacctgcgtcgtgagcccctgacttcaatcaccgacctacgaccttgaccgtcgttccgtatttgttgcga |
25100437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University