View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17451_low_2 (Length: 425)
Name: NF17451_low_2
Description: NF17451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17451_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 1 - 411
Target Start/End: Complemental strand, 35235564 - 35235154
Alignment:
| Q |
1 |
tgaggaaaagtcaagtacttagtcataggaactctaataagattcctcctagcattaatagcagatttctgaacagcagaaacaacttccttagctttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235564 |
tgaggaaaagtcaagtacttagtcataggaactctaataagattcctcctagcattaatagcagatttctgaacagcagaaacaacttccttagctttcc |
35235465 |
T |
|
| Q |
101 |
caacaccaacaccaactcgtccttgcttatcaccaacaacaacaatagccctaaacctcatttgtttccctcctttaacaaccttagtaaccctcctaac |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235464 |
caacaccaacaccaactcttccttgcttatcaccaacaacaacaatagccctaaacctcatttgtttccctcctttaacaaccttagtaaccctcctaac |
35235365 |
T |
|
| Q |
201 |
ttgaacaactctttcttccaacccatctcttatcttttccttctttacacccgaaccgaatgatgtatctttcctcgccttcttatccatcacatttata |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235364 |
ttgaataactctttcttccaacccatctcttatcttttccttctttacacccgaaccgaatccggtatctttcctcgccttcttatccatcacatttata |
35235265 |
T |
|
| Q |
301 |
tcatttccaagcacactaacaccactgtacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgttgtctatgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35235264 |
tcatttccaagcacactaacaccactgtacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgtcgtctatgg |
35235165 |
T |
|
| Q |
401 |
aaggtggtgga |
411 |
Q |
| |
|
||||||||||| |
|
|
| T |
35235164 |
aaggtggtgga |
35235154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University