View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_40 (Length: 372)
Name: NF17452_high_40
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 19 - 364
Target Start/End: Original strand, 53614855 - 53615200
Alignment:
| Q |
19 |
caaacatcagcagatgctccatcataccctttgctcatcagcagctgcaaatgaggaactatataagggtcacaaaatcaataataaatgtatcccataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53614855 |
caaacatcagcagatgctccatcataccctttgctcatcagcagctgcaaatgaggaactatttaagggtcacaaaatcaataataaatgtatcccataa |
53614954 |
T |
|
| Q |
119 |
taaaagtggtcactagcactctttctattggggagtctgggggagctctttagcgcgttgtagcacttggtgctcccttggactccccaacacgttccct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53614955 |
taaaagtggtcactagcactctttctattggagagtctgggggagctctttagcgcgttgttgcacttggtgctcccttggactccccaacacgttccct |
53615054 |
T |
|
| Q |
219 |
cactcgatcgtacctcaggagccacgtaacacggggatccacactttgtgtttaggacatcattaggctgcaaatgtatcaaaatttaatcgttaccaat |
318 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53615055 |
cactcgatcatacctcaggagccacgtaacacggggatccacactttgtgtttaggacattattaggctgcaaatttatcaaaatttaatcgttaccaat |
53615154 |
T |
|
| Q |
319 |
caaaaagtcttacaattgaactcgtgattagtatgaaacaaatttt |
364 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
53615155 |
caaaaagtcttacaattgaacttgtgattaggttgaaacaaatttt |
53615200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University