View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17452_high_66 (Length: 264)

Name: NF17452_high_66
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17452_high_66
NF17452_high_66
[»] chr3 (1 HSPs)
chr3 (1-245)||(34697981-34698225)


Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 34697981 - 34698225
Alignment:
1 agacaagagagaattttagaagacttacatgaataacgtcaactttaacaccgtcaatgcccaccgattccaaatgagagtgaagcccttcaaacatttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34697981 agacaagagagaattttagaagacttacatgaataacgtcaactttaacaccgtcaatgcccaccgattccaaatgagagtgaagcccttcaaacatttc 34698080  T
101 ttgggctaaatttggtggcactaagcctacaccattgttaacaatcttatccaccgctaaatcctccattgtcatcttcagccccggagacagcttcgga 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34698081 ttgggctaaatttggtggcactaaccctacaccattgttaacaatcttatccaccgctaaatcctccattgtcatcttcagccccggagacagcttcgga 34698180  T
201 gtaacaaccttagcttcgggcatgcccttcactttaggtctaacc 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
34698181 gtaacaaccttagcttcgggcatgcccttcactttaggtctaacc 34698225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University