View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_66 (Length: 264)
Name: NF17452_high_66
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 34697981 - 34698225
Alignment:
| Q |
1 |
agacaagagagaattttagaagacttacatgaataacgtcaactttaacaccgtcaatgcccaccgattccaaatgagagtgaagcccttcaaacatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34697981 |
agacaagagagaattttagaagacttacatgaataacgtcaactttaacaccgtcaatgcccaccgattccaaatgagagtgaagcccttcaaacatttc |
34698080 |
T |
 |
| Q |
101 |
ttgggctaaatttggtggcactaagcctacaccattgttaacaatcttatccaccgctaaatcctccattgtcatcttcagccccggagacagcttcgga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698081 |
ttgggctaaatttggtggcactaaccctacaccattgttaacaatcttatccaccgctaaatcctccattgtcatcttcagccccggagacagcttcgga |
34698180 |
T |
 |
| Q |
201 |
gtaacaaccttagcttcgggcatgcccttcactttaggtctaacc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698181 |
gtaacaaccttagcttcgggcatgcccttcactttaggtctaacc |
34698225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University