View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_72 (Length: 248)
Name: NF17452_high_72
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 41922751 - 41922621
Alignment:
| Q |
1 |
catgtcttaaattcttaataataagagcttgttgaagtcacactgagtttgacgatataatcggtagtacaatgatttcgttagaagttccaaagtgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41922751 |
catgtcttaaattcttaataataagcgcttgttgaagtcacagtgagtttgacgatataatcggtagtacaatgatttcgttagaagtttcaaagtgaaa |
41922652 |
T |
 |
| Q |
101 |
gtttatcaaatccaaagttgtacacaataat |
131 |
Q |
| |
|
|||| || ||||||||||||||||||||||| |
|
|
| T |
41922651 |
gtttgtcgaatccaaagttgtacacaataat |
41922621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University