View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17452_high_79 (Length: 240)

Name: NF17452_high_79
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17452_high_79
NF17452_high_79
[»] chr4 (2 HSPs)
chr4 (146-225)||(79009-79088)
chr4 (1-35)||(79195-79229)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 225
Target Start/End: Complemental strand, 79088 - 79009
Alignment:
146 gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
79088 gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgc 79009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 79229 - 79195
Alignment:
1 atacctgtttttccttttccctcctaattttagcc 35  Q
    |||||||||||||||||||||||||||||||||||    
79229 atacctgtttttccttttccctcctaattttagcc 79195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University