View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_79 (Length: 240)
Name: NF17452_high_79
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 225
Target Start/End: Complemental strand, 79088 - 79009
Alignment:
| Q |
146 |
gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
79088 |
gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgc |
79009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 79229 - 79195
Alignment:
| Q |
1 |
atacctgtttttccttttccctcctaattttagcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
79229 |
atacctgtttttccttttccctcctaattttagcc |
79195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University