View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_81 (Length: 238)
Name: NF17452_high_81
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 32608659 - 32608450
Alignment:
| Q |
13 |
aatatgaagttcttcccctaggactaatttactagtacaacaggtttcctttttt-gtaaacatatttttgttgcaggaaatgtgcttgacattggttgc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32608659 |
aatatgaagttcttcccctaggactaatttactagtacagcaggtttcctttttttgtaaacaaatttttgttgcaggaaatgtgcttgatattggttgc |
32608560 |
T |
 |
| Q |
112 |
ttccaataataatcttgcgcgactcttataatgcctgactctcaaatattgtatttacataaagactctttttctgtttcattaatgccatctattaacc |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32608559 |
ttccaataataatcttgcacgactcttataatgcttgactctcaaatattgtatttacataaagactctttttctgtttcattaatgccatctattaacc |
32608460 |
T |
 |
| Q |
212 |
acacaaacat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
32608459 |
acacaaacat |
32608450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University